Abstract:

This dataset contains mRNA sequences and log fold change of the differentially expressed gene of red drum intraperitoneal injection with south Louisiana crude oil.

Suggested Citation:

Wetzel, Dana. 2017. Significant differential gene expression in red drum intraperitoneal injected with Louisiana crude oil. Distributed by: GRIIDC, Harte Research Institute, Texas A&M University–Corpus Christi. doi:10.7266/N73T9F7J

Purpose:

Controlled exposure studies were used to develop genomic and other biomarkers of oil exposure.

Data Parameters and Units:

Red drum assembled nucleic acid sequence for DEG.txt - Sequences are in Fasta format as follows; >TRINITY_DN31583_c2_g1_i1 len=266 path=[244:0-265] [-1, 244, -2] GAGATATAACATGATCTTTCAGTGGCTGCT……………… Trinity is the software used to assemble the RNA sequence fragments. The DN number is the transcript ID, c#=cluster number, g#=gene number, i#= isolate number, len = is the length of the transcript in base pairs of nucleotides, path is the assembly of the transcripts. Significant differential gene expression in red drum intraperitoneal injected with Louisiana crude oil.xlsx - column A is the transcript ID number, column B is the log2Fold change of gene expression compared to the untreated control, column C is the significance of the fold change with p < 0.01, column D is the protein description from the Blast2GO analysis, column E is the GO (gene ontology) ID number, term, and category. ExposureEvents.csv - T (time, hr), Number of fish

Methods:

Next generation sequencing using RNA-seq IP Injection information: I. Intrapertoneal (IP) injections of South Louisiana crude oil: This treatment, commonly used in toxicity studies, provides an opportunity to determine acute biochemical responses to direct exposure to oil. While this does not simulate normal exposure to oil, this procedure can be helpful in identifying potential biological changes. II. As recommended by other toxicity studies, fish were injected at 2 ml of crude oil per kg of fish with a 2:1 (crude oil: corn oil) carrier matrix. III. There were four fish from each species injected with the crude/corn oil mixture and 4 fish from each species injected with corn oil only. IV. The schedule for dose and sacrifice is shown in the csv file titled "Exposure Events" V. There were also two fish from each species sacrificed at time=0 to establish normal baseline values.

Individual Files: