Abstract:
Little is known about the ability of microorganisms to degrade the polar components of crude oil, which are of significant interest because they are more water-soluble and potentially more toxic to marine biota than the non-polar components. Our project seeks to address this gap in knowledge by examining the microbial degradation of the polar components of crude oil in seawater mesocosms using microbial metagenomics (both 16S rRNA amplicon sequencing and shot gun metgenomics). Mesocosms were composed of a natural seawater bacterial consortia exposed to crude oil-derived compounds dissolved in sterile seawater with three sets of controls: (1) sterile seawater with oil-derived water-soluble compounds; (2) a natural seawater bacterial consortia amended with succinic acid, which was used as a simple carbon source instead of crude oil and; (3) an unamended natural seawater bacterial consortia. All incubation sets were supplemented with nutrients and kept in the dark at room temperature for 14 days. Samples were taken in triplicate on T=0, T=7 and T=14. Microbial community structure has been analysed using targeted sequencing of the 16S rRNA gene. Analysis of the function of the microbial community has been performed via shotgun metagenomic sequencing.
Suggested Citation:
Helen K White. 2016. Using Comparative Metagenomics to Analyze Microbial Degradation of Polar Crude Oil Components. Distributed by: GRIIDC, Harte Research Institute, Texas A&M University–Corpus Christi. doi:10.7266/N7W95762
Methods:
Construction and Sequencing of v3-v4 16s Metagenomic libraries: Purified genomic DNA was submitted to the University of Wisconsin-Madison Biotechnology Center. DNA concentration was verified using the Qubit® dsDNA HS Assay Kit (Life Technologies, Carlsbad, California, USA). Samples were prepared as described in the 16S Metagenomic Sequencing Library Preparation Protocol, Part # 15044223 Rev. B (Illumina Inc., San Diego, California, USA) with the following modifications: The 16S rRNA gene V3/V4 variable region was amplified with nested primers (forward primer: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3’, reverse primer: 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3’), Region specific primers were previously described in Klindworth et al., 2013, and were modified to add Illumina adapter overhang nucleotide sequences to the gene‐specific sequences. Following initial amplification, library size was verified on an Agilent DNA1000 chip, and cleaned using a 1x volume of AxyPrep Mag PCR clean-up beads (Axygen Biosciences, Union City, CA). Illumina dual indexes and Sequencing adapters were added using the following primers (Forward primer 5’-AATGATACGGCGACCACCGAGATCTACAC[55555555]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’, Reverse Primer: 5’-CAAGCAGAAGACGGCATACGAGAT[77777777]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3’, where bracketed sequences are equivalent to the Illumina Dual Index adapters D501-D508 and D701-D712). Following PCR, cleaned using a 1x volume of AxyPrep Mag PCR clean-up beads (Axygen Biosciences). Quality and quantity of the finished libraries were assessed using an Agilent DNA1000 chip and Qubit® dsDNA HS Assay Kit, respectively. Libraries were standardized to 2μM and pooled prior to sequencing. Paired end, 300 bp sequencing was performed using the Illumina MiSeq Sequencer and a MiSeq 600 bp (v3) sequencing cartridge. Images were analyzed using the standard Illumina Pipeline, version 1.8.2. Construction and Sequencing of Whole Genome Metagenomic libraries: Purified genomic DNA was submitted to the University of Wisconsin-Madison Biotechnology Center. DNA concentration and sizing were verified using the Qubit® dsDNA HS Assay Kit (Life Technologies, Carlsbad, California, USA) and Agilent DNA High Sensitivity chip (Agilent Technologies, Inc., Santa Clara, CA, USA), respectively. Samples were prepared according the TruSeq® PCR Free Sample Preparation kit (Illumina Inc., San Diego, California, USA) with minor modifications. Libraries were size selected for an average insert size of 550 bp using SPRI-based bead selection. Quality of the finished libraries was assessed using an Agilent High Sensitivity chip and qPCR quantification was performed using the Kapa Illumina NGS Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Two libraries, WSF_Control_T0 and Incoculum, did not produce enough library to load on the sequencer, so minimal (6) PCR cycles were performed as follows to increase the library concentration prior to sequencing: samples were brought up to 25ul with Resuspension Buffer (Illumina Inc, p/n 15026770) and combined with 5uL of TruSeq PCR Primer Cocktail (Illumina Inc, p/n 15031748) and 20 uL of KAPA HiFi HotStart ReadyMix (KAPA Biosystems) . Thermocycler conditions were: 95C for 3 min; 6 cycles of 98C for 20 seconds, 60C for 15 seconds, 72C for 30 seconds; 72C for 5min final extension. The resulting amplification reactions were cleaned using a 1x volume of AxyPrep Mag PCR clean-up beads (Axygen Biosciences, Union City, CA) and then Qubit dsDNA HS (Life Technologies) quantification was performed. Libraries were standardized to 2μM. Cluster generation was performed using standard Cluster Kits (v3) and the Illumina Cluster Station. Paired end, 150 bp sequencing was performed, using Illumina Rapid SBS chemistry (v1) on an Illumina HiSeq2500 sequencer. Images were analyzed using the standard Illumina Pipeline, version 1.8.2.
View Metadata